PROTECT YOUR DNA WITH QUANTUM TECHNOLOGY
Orgo-Life the new way to the future Advertising by Adpathway-
Loading metrics
Open Access
Peer-reviewed
Research Article
- Jana Brunner,
- Anca Neagu,
- Dimos Gaidatzis,
- Lucas J. Morales Moya,
- Helge Großhans
x
- Published: August 4, 2026
- https://doi.org/10.1371/journal.pbio.3003892
Abstract
The RNA-binding protein (RBP) LIN28 is a key regulator of temporal cell fates, promoting stem cell identity and suppressing differentiation. It regulates the processing of the let-7 miRNA but additionally binds thousands of mRNAs, suggesting a model of coordinated regulation across many targets. Yet, direct evidence for such a network function is scarce for both LIN28 and other broadly binding RBPs. Here, we show that in Caenorhabditis elegans larvae, loss of LIN28 leaves the levels of most LIN28-bound transcripts unchanged. The only exceptions are the lin-46 mRNA and the let-7 miRNA. Comprehensive genetic analyses identify these two as the functionally essential LIN28 targets: lin-28; lin-46; let-7 triple mutant animals exhibit complete suppression of the lin-28(0) precocious heterochronic phenotypes and recapitulate the retarded lin-46; let-7 double mutant phenotypes. Conversely, simultaneous overexpression of lin-46 and let-7 mimics LIN28 loss. Unexpectedly, LIN28 controls not only cell identity but also the tempo of development, using the same two targets. These findings establish a close functional link between the heterochronic pathway and the clock regulating developmental tempo and demonstrate that an RBP can achieve complex biological outcomes through a small set of targets.
Citation: Brunner J, Neagu A, Gaidatzis D, Morales Moya LJ, Großhans H (2026) let-7 miRNA and lin-46 mRNA are essential targets of the LIN28 RNA-binding protein in Caenorhabditis elegans developmental timing regulation. PLoS Biol 24(8): e3003892. https://doi.org/10.1371/journal.pbio.3003892
Academic Editor: Amy E. Pasquinelli, University of California San Diego, UNITED STATES OF AMERICA
Received: April 22, 2026; Accepted: June 22, 2026; Published: August 4, 2026
Copyright: © 2026 Brunner et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All RNA-seq data are accessible at NCBI’s Gene Expression Omnibus [68] under SuperSeries accession number GSE315957 at https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE315957. Custom code is available on Zenodo at https://doi.org/10.5281/zenodo.20742641. Phenotypic quantification data are available on Zenodo at https://doi.org/10.5281/zenodo.20787133.
Funding: This work was supported by the EC | European Research Council (ERC; https://erc.europa.eu/homepage): 741269 to H.G.; Schweizerischer Nationalfonds zur Förderung der Wissenschaftlichen Forschung (SNF; https://www.snf.ch/en): 188487 & 219271 (to H.G.); Novartis Research Foundation (FMI Core Funding). The funders did not play any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Abbreviations: DIC, Differential Interference Contrast; FDR, false discovery rate; J/A, juvenile-to-adult; RBP, RNA-binding protein; RIP, RNA-Immunoprecipitation; RT, reverse transcription
Introduction
Many animals undergo major morphological, physiological and/or behavioral changes as they become adults. Some of the genetic mechanisms that control this juvenile-to-adult (J/A) transition, known as puberty in mammals, exhibit extensive evolutionary conservation [1–3]. Thus, in Caenorhabditis elegans, heterochronic genes act as temporal patterning factors that determine stage-specific cell fates. Mutations in these genes cause either reiteration of earlier fates (retarded phenotypes) or skipping of earlier fates in favor of direct transition to a later fate (precocious phenotypes). A notable example is lin-28, which encodes an RNA-binding protein, and whose loss of function causes a precocious execution of the J/A transition [4, 5]. Its mammalian orthologues LIN28A and LIN28B (collectively LIN28 in the following) control puberty onset in mice and humans [6–9] (reviewed in [10]).
In both C. elegans and mammals, LIN28 functions, at least in part, by regulating biogenesis of the highly conserved miRNA let-7, preventing its precocious accumulation [11–17]. At the cellular level, LIN28 and let-7 act antagonistically in controlling cell fates. While LIN28 promotes self-renewal, proliferation and “stemness”, let-7 drives differentiation. Together they form a regulatory module operating in diverse developmental, pathological and cell engineering contexts [18, 19].
Despite this important, phylogenetically conserved role of the LIN28–let-7 module, additional LIN28 targets must exist in C. elegans: In the absence of further targets, let-7 would be epistatic to lin-28, i.e., lin-28; let-7 double null mutant animals should exhibit the retarded phenotypes characteristic of let-7 single mutant animals. Instead, these animals exhibit intermediate (or mutually suppressive) phenotypes. For instance, a cuticular structure known as adult alae form in wild-type animals at the fourth and final molt, M4. Loss of lin-28 function causes precocious alae formation one or even two molts earlier, at M3 or M2, whereas let-7 mutant animals fail to form alae even at M4. lin-28; let-7 double mutant animals have partial alae at M4, but not before [20, 21].
One additional LIN28 target is the lin-46 mRNA, which LIN28 represses by binding to its 5′ untranslated region (5′UTR) [22]. Like let-7, lin-46 interacts genetically with lin-28, and double mutations show mutual suppression [23]. However, many more targets are thought to exist: CLIP-seq revealed binding of LIN28 to more than 1,000 mRNAs, while yeast three-hybrid assays supported binding to precursors of the three let-7 sister miRNAs, miR-48, miR-84 and miR-241 [24, 25].
Whether and to which extent these numerous interactions are functionally relevant remains mostly unknown. This is also true in mammalian cells where LIN28 was similarly reported to bind thousands of transcripts [26–29]. Although diverse molecular outcomes have been reported, including transcript stabilization, destabilization, translational repression or activation [30], the observed effects are mostly modest and restricted to a fraction of the bound RNAs. Hence, it has been proposed that mRNA binding does not serve regulation of the mRNA, but sequesters LIN28 away from let-7, thereby permitting processing of the miRNA [31, 32]. Such a lack of individually important mRNA regulatory events could potentially explain why mammalian LIN28 RNA interactomes appear to differ greatly across different studies [19].
Here, we integrate RNA-binding and mRNA and miRNA expression data to identify LIN28-regulated RNAs in C. elegans. Surprisingly, among hundreds of bound mRNAs, only lin-46 levels increase significantly in lin-28 mutant animals, and among miRNAs, only let-7 is significantly upregulated. Consistent with these observations, genetic interaction studies reveal that LIN28’s somatic function in temporal patterning can be parsimoniously explained through only these two targets. Unexpectedly, loss of LIN28 also substantially slows overall development, dependent on derepression of let-7 and lin-46. Hence, beyond acting as temporal patterning genes that organize developmental stages in a defined order, heterochronic genes may also control the tempo of development.
Results
LIN28 binding poorly predicts mRNA level changes
To identify functional targets of C. elegans LIN28, we performed RNA immunoprecipitation followed by sequencing (RIP-seq) by immunoprecipitating endogenously tagged LIN28. (We will refer to the relevant strain as lin-28::large_tag in the following to indicate that, in addition to the GFP epitope used in this experiment, it contains additional tags (Fig 1A). Note that although the animals appear superficially wild-type, we show below evidence that tagging subtly impairs the activity of the LIN28 protein.) Examining mid-L1 stage animals (6 h at 25 °C after plating larvae hatched in the absence of food), we found 581 transcripts enriched for LIN28 binding (≥2-fold, Fig 1B). Notably, this set overlapped significantly with targets identified by [24] through HITS-CLIP (110/1015; 3.7-fold over expectation, p = 1.7 × 10−34 hypergeometric test), despite differences in animal stage, genetic background, and experimental procedure.
Fig 1. let-7 and lin-46 stand out among LIN28 candidate targets.
A: Schematic representation of the lin-28 genomic locus with two lin-28 isoforms. Mutant alleles and endogenously tagged alleles used in this study are indicated. Allele numbers refer to modifications in otherwise wild-type backgrounds except the lin-28b isoform-specific exon deletion, xe344, which was introduced into an endogenously FLAG::HA-tagged background (xe59). The “large tag” xe197 allele corresponds to a C-terminal insertion of linker::AID::3xFLAG::TEV::GFP::linker::HiBit sequence. B: Volcano plot showing transcript enrichment in LIN28::large_tag IP compared to untagged control IP (N2). Immunoprecipitation was performed with anti-GFP antibody on lysates from synchronized early L1-stage animals collected at 6 h of development at 25 °C (n = 3 IP replicates). Transcripts significantly enriched (FDR ≤ 0.01, log2(FC) > 1) are indicated in red. Data available at GEO under SuperSeries accession number GSE315957 (sample IDs GSM9440832 - GSM9440843). C: Volcano plot showing differential gene expression in lin-28(0) animals relative to wild type. Log2 fold change in gene expression was quantified by RNA-seq of synchronized animals collected hourly from 3 to 6 h at 25 °C in three biological replicates. The x-axis represents the average expression of each gene across the three biological replicates, with different time point samples pooled for each replicate. Three genes with significant expression changes (adjusted p-value < 0.01, threshold indicated by horizontal dashed line) are labeled by name. Genes whose transcripts are bound by LIN28 (from (B)) are indicated in red. F02E9.3 expression was undetectable in both input and IP samples of LIN28::large_tag RIP-seq (shown in (B)). Data available at GEO under SuperSeries accession number GSE315957 (sample IDs GSM9440875 - GSM9440878, GSM9440920 - GSM9440923, GSM9441623 - GSM9441630 and GSM9441631 - GSM9441638). D: Expression levels of lin-46 mRNA in wild-type and lin-28(0) animals as determined by mRNA-seq. Animals were grown at 25 °C with hourly sampling. Data available at GEO under SuperSeries accession number GSE315957 (sample IDs GSM9440872 - GSM9440961). E: Plot showing log2-transformed read counts of pri-let-7 in input and IP samples from LIN28::large_tag animals and untagged control animals (N2). Data are from the same LIN28::large_tag RIP-seq experiment as shown in (B). Red horizontal lines indicate the mean of three technical IP replicates. Significant differences were determined by an unpaired two-sided t test (ns: not significant; ***p < 0.001). Data available at GEO under SuperSeries accession number GSE315957 (sample IDs GSM9440832 - GSM9440843). F: Levels of mature let-7 miRNA in wild-type and lin-28(0) animals as determined by small RNA-seq. The two dashed lines indicate the window of time points pooled for differential gene expression analysis in (G). Samples are identical to those in (D). Data available at GEO under SuperSeries accession number GSE315957 (sample IDs GSM9441669 - GSM9441710) and GSE245904 (sample IDs GSM7850636 - GSM7850683). G: Scatterplot comparing miRNA expression in wild-type and lin-28(0) animals. miRNA expression levels were quantified by small RNA-seq of lysates from synchronized animals collected hourly from 3 to 6 h at 25 °C. This corresponds to a subset of samples from the series shown in (F) but sequenced to greater depth and published previously in [33]. Samples were treated as pseudoreplicates for statistical testing, with the average miRNA expression across the four time points plotted. Two miRNAs with significant expression changes are colored in red (FDR < 0.01). let-7 sisters are labeled in gray. Data available at GEO under SuperSeries accession number GSE245904 (sample IDs GSM7850639 - GSM7850642 and GSM7850663 - GSM7850666).
The role of LIN28 and its molecular mechanisms have previously been studied using lin-28(n719), an allele isolated after chemical mutagenesis that carries a point mutation in the 5′ splice donor of the second exon and that is considered null [4, 5]. To investigate the consequences of a complete loss of LIN28 in a genetically clean background, we used CRISPR-Cas9-mediated genome editing to introduce a ~3.2 kb long deletion spanning the whole lin-28 locus (lin-28(xe192), henceforth referred to as lin-28(0), Fig 1A). As we show below, lin-28(0) mutant animals recapitulate published lin-28(n719) mutant phenotypes [4, 34], yet the two strains shared surprisingly few dysregulated genes (S1 Fig). Specifically, when compared to the wild-type N2 strain, many more genes were dysregulated in lin-28(n719) than in lin-28(0), suggesting differences in strain background or additional mutations in the former.
To identify genes with robust changes in expression, we collected samples of several time points and in replicates for lin-28(0) and wild-type animals. We focused on the early first larval stage (eL1; 3–6 hours of development on food at 25 °C), a time window when LIN28 levels are high [5, 35] and potentially confounding rhythmic mRNA expression has not yet begun [36, 37]. For one of these experiments, sampling was extended to cover the entire course of larval development to allow assessment of mRNA trajectories over time. For those samples, we also sequenced small RNAs (see below).
Strikingly, besides lin-28 mRNA itself, the levels of only two mRNAs changed significantly in lin-28(0) animals (Fig 1C). The change in the first one, F02E9.3, is likely an artifact: It is not bound by LIN28 and its locus is immediately downstream of lin-28, suggesting that deletion of the lin-28 coding sequence placed this gene under the control of the lin-28 promoter. Consistent with this notion, F02E9.3 levels were unaffected in lin-28(n719) animals (S1A Fig).
By contrast, the second transcript, lin-46, is not only bound by LIN28, but is also among the few transcripts whose levels were upregulated in both lin-28(0) and lin-28(n719) animals (S1A Fig). Moreover, regulation of lin-46 by LIN28 had previously been reported and was proposed to occur at the level of translation [22, 23]. The long timecourse revealed that the levels of lin-46 mRNA are dynamic in wild-type worms, with a notable increase during mid/late L1 (~10 h) and again at ~18 hours (~mid-L2; Fig 1D). In lin-28(0) animals, lin-46 mRNA levels are upregulated during the first 18 hours of development (Fig 1D), i.e., the time when LIN28 protein is abundant in wild-type animals [5, 35]. These observations suggest that LIN28 represses lin-46, at least in part, by destabilizing its transcript.
let-7 is the only significantly upregulated miRNA in lin-28 mutant animals
The best-characterized LIN28 target in C. elegans as elsewhere is the let-7 miRNA [13, 16, 24, 33], and our RIP-seq analysis confirmed binding of the primary let-7 transcript to LIN28 (Fig 1E). (Note that Fig 1B displays only mRNAs.) We had previously reported small RNA sequencing of the first 23 h of the long timecourse, which had revealed extensive upregulation of let-7 miRNA levels in lin-28(0) animals [33]. Interestingly, when we extended this analysis to the whole timecourse, we observed that the upregulation was specific to early larval development, whereas from ~25 h onward, let-7 levels were identical in wild-type and lin-28 mutant animals (Fig 1F). This temporal pattern is consistent with the known restriction of LIN28’s activity to the early larval stages [5, 35].
To examine whether LIN28 regulates the expression of other miRNAs, we determined differentially expressed miRNAs in the time window of 3–6 hours investigated also for mRNAs above. Using the four time points as pseudoreplicates for statistical testing, only let-7 and one other miRNA, miR-229-3p, changed significantly. In contrast to let-7, miR-229-3p levels were decreased, not increased, in lin-28(0) animals (Figs 1G and S2). We expressly note that the let-7 sister miRNAs, miR-48, miR-84, and miR-241 were unaffected (Figs 1G and S2).
Taken together, although LIN28 binds hundreds of transcripts, only a few of these binding events yield substantial changes in transcript levels. We consider three possible explanations: First, LIN28 may act preferentially through regulatory mechanisms other than RNA destabilization, e.g., through translational control. Second, most instances of binding may not result in actual regulation and could be biologically inconsequential. Third, many of the binding events may be false positives. To distinguish among these scenarios, we sought to investigate to what extent regulation of only let-7 and lin-46 can account for the developmental functions of LIN28.
lin-46 but not let-7 is required for the protruding vulva phenotype of lin-28(0) animals
Animals lacking LIN28 exhibit numerous heterochronic phenotypes, such as a protruding vulva due to precocious vulval precursor cell division, a precocious synthesis of the adult-specific skin structure called alae and a precocious cessation of the molting cycle after three instead of the wild-type four molts [4, 34]. We hypothesized that if let-7 and lin-46 were the only two developmentally relevant LIN28 targets, we should be able to explain these phenotypes by misregulation of just these two genes. In other words, mutating one or both target genes in the background of the lin-28(0) mutation should fully suppress the precocious lin-28 mutant phenotypes. Moreover, the phenotypes resulting from their combined deletion should not be further modulated by loss of LIN28, their upstream repressor; i.e., lin-28; lin-46; let-7 triple mutant animals should recapitulate the retarded lin-46; let-7 double mutant phenotypes.
To test these two predictions, we used a previously published lin-46(0) allele, lin-46(ma385) (a ~1.6 kb deletion spanning all lin-46 exons [38]), and a newly generated let-7 allele, let-7(xe150), which carries an ~1 kb deletion of the promoter region (S3A Fig). Considering the massive effect on let-7 synthesis (S3B and S3C Fig) and the full recapitulation of previously described let-7 mutant phenotypes as described below, let-7(xe150) is a strong hypomorph and we will refer to it as let-7(−) in the following.
First, we examined vulval development. lin-28(0) animals exhibit a fully penetrant protruding vulva (Pvl) phenotype, which we find to be fully suppressed by the lin-46(0) allele (Fig 2A), as reported earlier [23]. By contrast, this phenotype is not suppressed by a let-7(−) mutation (Fig 2A). Instead, lin-28(0) suppresses a vulval phenotype associated with let-7(−): let-7(−) mutant animals have a functionally deficient vulva through which they burst as young adults (Fig 2B and [20])—a phenotype that is absent from lin-28(0); let-7(−) double mutant animals. This finding can either be interpreted as let-7 functioning upstream of lin-28 or as evidence for lin-28 regulating additional targets that act in parallel to let-7. Consistent with the latter scenario, we found that lin-28(0); lin-46(0); let-7(−) triple mutant animals phenocopied let-7(−) single mutant animals, exhibiting fully penetrant vulval bursting (Fig 2B).
Fig 2. lin-46 but not let-7 is required for the lin-28(0) mutant protruding vulva (Pvl) phenotype.
A: Example DIC images of vulvae in the indicated genetic backgrounds. The animals were grown at 20 °C and examined shortly after exit from the final molt, i.e., the fourth molt in all cases except lin-28(0) animals, which execute only three molts and were grown at 25 °C. Arrow indicates the pathological vulva protrusion (Pvl). The percentage of animals exhibiting the Pvl phenotype is indicated. Scale bars: 10 µm. B: Quantification of vulva bursting of adult animals of indicated genotypes. Animals were grown at 25 °C and examined at 48 h of development. N = 3 technical replicates, with n = 240 animals scored per genotype. Error bars represent standard deviation. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133).
Taken together, our findings are consistent with let-7 and lin-46 acting in parallel pathways as targets of LIN28 with a partially redundant function in vulval development. Dysregulation of lin-46 appears to chiefly account for the Pvl phenotype of lin-28(0) animals.
Both let-7 and lin-46 are required for the precocious alae synthesis in lin-28(0) animals
Second, we evaluated the formation of alae, an adult-specific cuticular structure. In wild-type animals, alae are generated during the fourth molt. In contrast, lin-28(0) animals form alae precociously with 98% and 81% of animals having at least some alae already after the third molt when grown at 20 °C and 25 °C, respectively (Figs 3A and S4). In fact, and consistent with earlier work [4], nearly half of the lin-28(0) animals exhibit alae as early as immediately after the second molt, but these alae are weak and incomplete (Figs 3A, 3B, and S4). The precocious alae synthesis is strongly suppressed by loss of either lin-46 or let-7, with no or very rare alae in lin-28(0); lin-46(0) and lin-28(0); let-7(−) double mutant animals after the third molt, respectively (Fig 3A).
Fig 3. The precocious alae phenotype of lin-28(0) animals is suppressed by loss of either let-7 or lin-46.
A: Quantification of the presence of alae in animals of indicated genotypes. Molting animals were singled and examined shortly after they exited the respective molt as indicated by ecdysis. Phenotypes of lin-28(0) and lin-28(0); let-7(−) animals were quantified twice on different days and the results were pooled in the presented table. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). B: Example DIC images of alae in the indicated genetic backgrounds. The animals were grown at 20 °C and examined shortly after the exit from the indicated molt, with the exception of the “lin-28(0) M2” condition in which the animals were grown at 25 °C. Arrowheads point to the alae. The dashed line indicates the alae gap. Scale bars: 10 µm.
Conversely, the lin-28(0) allele suppresses the alae phenotypes of the individual target mutations. Upon exit from the fourth molt, lin-46(0) animals have either complete (67%) or gapped (33%) alae, while all lin-28(0); lin-46(0) animals display complete, gap-free alae (Figs 3A, 3B, and S4). At the same developmental stage, let-7(−) animals lack alae entirely, whereas around half of lin-28(0); let-7(−) animals exhibit weak partial alae (Figs 3A and S4). These findings again argue against a simple linear pathway where LIN28 controls alae formation through a single target. To determine whether regulation of let-7 and lin-46 is sufficient, we compared alae formation in lin-46(0); let-7(−) double and lin-28(0); lin-46(0); let-7(−) triple mutant animals. As in let-7(−) single mutant animals, neither strain formed any alae even after the fourth molt (Fig 3A), supporting the conclusion that let-7 and lin-46 are likely the sole targets mediating LIN28’s role in the temporal control of alae synthesis. Moreover, unlike for the Pvl phenotype, dysregulation of both lin-46 and let-7 is required for precocious alae formation in lin-28(0) mutant animals.
Both let-7 and lin-46 are required for the precocious exit from the molting cycle in lin-28(0) animals
Animals lacking LIN28 were previously reported to execute only three instead of the wild-type four larval molts [4]. To examine the contributions of let-7 and lin-46, we employed a high-throughput assay allowing us to quantify the number of molts based on the alternating periods of feeding and lethargus in developing larvae [37, 39]. Briefly, animals expressing a luciferase transgene are provided with a medium containing luciferin, the luciferase substrate. As the animal grows and feeds, luciferin is ingested and, consequently, luminescence signal is emitted. When the animal enters a molt, it stops feeding and the signal decreases steeply, generating a characteristic luminescence intensity pattern (Fig 4A).
Fig 4. The precocious exit from the molting cycle of lin-28(0) animals is suppressed by both let-7(−) and lin-46(0).
A: Examples of luminescence intensity traces. Vertical blue bars indicate molts. Red arrow points to the signal increase indicative of vulva bursting. Blue arrow points to a sudden signal increase, the 4M* phenotype. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). B: Quantification of the number of molts in animals of the indicated genotypes. The number at the bottom of each bar indicates the number of examined animals (n). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). C: Example DIC images of the head (top row) and the vulva (bottom row) regions of lin-28(0); lin-46(0) animals that underwent a normal (left, 4M) or aberrant (middle and right, 4M*) fourth molt. The animals were extracted from the luciferase assay plate after 52 h, classified according to their luminescence intensity pattern and examined under the microscope. The 4M* animals exhibited a defect in pharyngeal cuticle shedding ranging from a part of the old cuticle remaining attached to the animal through the mouth plug (middle, white arrow) to a ripped-out pharynx (right, pharynx traced with a red dashed line, head traced with a white dashed line). All 4M* animals exhibited egg-laying defect as demonstrated by the retained embryos of advanced developmental stages. Scale bars: 10 μm. D: Quantification of the number of molts in animals of the indicated genotypes grown on either empty-vector-containing (control) or cdk-1 RNAi bacteria. Color key as in (B). The wild-type and lin-28(0) conditions are replotted from (B). The number at the bottom of each bar indicates the number of examined animals (n). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133).
The analysis revealed the expected four molts in wild-type and three in lin-28(0) animals (Fig 4A and 4B). The precocious exit from the molting cycle observed upon LIN28 loss requires the activities of both let-7 and lin-46, as both lin-28(0); let-7(−) and lin-28(0); lin-46(0) double mutant animals undergo more than three molts (Fig 4A and 4B). However, in the case of lin-28(0); lin-46(0) double mutants, suppression was only partial: nearly half of the animals exhibit a defect during the fourth molt (henceforth referred to as the 4M* phenotype) (Fig 4B): After completing three properly executed molts, a steep increase in the luminescence intensity occurred at a time where wild-type animals would exhibit the signal drop typical of feeding cessation (Fig 4A). This unusual signal reflects a severe defect in shedding of the pharyngeal cuticle, with the anterior part of the old cuticle remaining attached via the mouth plug (Fig 4C, middle). In extreme cases, the pharynx appears to be partially ripped out, likely due to mechanical forces applied during failed cuticle shedding (Fig 4C, right). Additionally, late-stage embryos accumulate in the affected animals, indicating an egg-laying defect (Fig 4C), possibly a consequence of embryo retention due to starvation [40]. We note that the 4M* phenotype is specific to liquid culture, as lin-28(0); lin-46(0) animals appear wild-type when grown on agar plates.
lin-46(0) mutant animals undergo the wild-type number of four molts. By contrast, if let-7(−) animals are prevented from vulval bursting, they execute additional molts. Thus, 100% of let-7(−) animals depleted of CDK-1 to prevent vulva formation [41] undergo extra molts (Fig 4D). The lin-28(0) mutation not only fully suppressed vulval bursting, but also partially suppressed the extra molt phenotype with 24% of lin-28(0); let-7(−) double mutant animals undergoing the normal number of molts, four (Fig 4A and 4B). This suppression depended on lin-46: Like let-7(−) single and lin-46(0); let-7(−) double mutant animals, all lin-28(0); lin-46(0); let-7(−) triple mutant animals executed supernumerary molts when grown on cdk-1 RNAi (Fig 4C). We conclude that let-7 and lin-46 are the essential targets of LIN28 for controlling molt number. As for the alae phenotype, precocious termination of the molting cycle in lin-28(0) mutant animals appears to require dysregulation of both lin-46 and let-7.
Mutation of the putative LIN28 binding site in the primary let-7 transcript does not alter let-7 levels
With the suppression analysis, we tested whether the two LIN28 targets, let-7 and lin-46, are necessary for lin-28 mutant phenotypes. Next, we wanted to test whether the precocious expression of these targets is sufficient to induce those phenotypes. Thus, we aimed to use genome editing to uncouple the two targets from LIN28-imposed repression.
In humans, LIN28 recognizes a GGAG motif located in the apical part of the let-7 hairpin [42–44]. However, the let-7 hairpin in C. elegans lacks this motif, and instead, LIN28 has been proposed to bind a downstream region outside of the actual hairpin ([24]; S3A Fig). This region contains four GGAG motifs, which have been implicated in LIN28 binding in vitro [24]. To uncouple let-7 from LIN28-mediated repression in vivo, we mutated all four motifs in the endogenous let-7 locus, changing them from GGAG to CTCC (let-7(xe336), henceforth referred to as let-7(ΔBS) for mutation of the putative Binding Sites) (S3A Fig). However, this mutation did not result in appreciable let-7 derepression, as mature let-7 levels remained largely unaffected (S3D Fig), suggesting that the four GGAG motifs in the putative LIN28 binding site are not required for let-7 repression in vivo, possibly due to redundancy with other binding sites or repressive mechanisms. (We have not determined whether LIN28 binding was perturbed by these mutations.)
Mutation of the putative LIN28 binding site in lin-46 5′UTR results in weakly precocious LIN-46 accumulation
The lin-46 transcript is bound by LIN28 (Fig 1B and [24]) and the lin-46 5′UTR has been shown to prevent precocious accumulation of LIN-46 protein during development [22]. To uncouple lin-46 from LIN28, we mutated the single GGAG motif in the short endogenous lin-46 5′UTR to CTCC (lin-46(xe370), henceforth referred to as lin-46(++)). To evaluate the levels of lin-46 mRNA, we collected samples of synchronized animals hourly from 5 to 14 hours of development (i.e., from early/mid-L1 to early/mid-L2) and performed mRNA-seq. As shown in Fig 5A, lin-46 mRNA levels were upregulated to an intermediate level in lin-46(++) animals, with the characteristic increase at ~8–9 hours observed in wild-type animals preserved (Fig 5A, compare with Fig 1D).
Fig 5. Mutation of the GGAG motif in lin-46 5′ UTR recapitulates the precocious LIN-46 accumulation seen in lin-28(0) animals only partially.
A: Levels of lin-46 mRNA as determined by mRNA-seq of synchronized animals collected hourly from 5 to 14 h of development at 25 °C. Data available at GEO under SuperSeries accession number GSE315957 (sample IDs GSM9441639 - GSM9441668). B: Confocal images of endogenously split-GFP-tagged LIN-46 in the epidermal seam cells of wild-type, lin-46(++) and lin-28(0) animals. Animals were grown at 25 °C and examined at the indicated time points. Arrowheads indicate seam cells with detectable GFP signal. An arrow points to the predominantly nuclear accumulation of LIN-46 in lin-28(0) animals. Scale bars: 10 μm. C: Confocal images of endogenously split-GFP-tagged LIN-46 in the epidermal seam cells of lin-28(0) and lin-28(0); lin-46(++) animals. Animals were grown at 25 °C and examined at the indicated time points. Arrowheads indicate seam cells with detectable GFP signal. Scale bars: 10 μm.
To determine whether this mild increase in lin-46 mRNA levels also manifests at the protein level, we examined endogenous LIN-46 protein C-terminally tagged with a 4xsplit-GFP (lin-46(xe347)). In agreement with previously published observations using a different fluorophore [22], we detected LIN-46 in wild-type animals in the epidermal seam cells (Fig 5B), as well as in the vulval precursor cells, tail and rectum (S5 Fig). Focusing on the seam cells, we observed LIN-46 accumulation starting in late L3 (24–26 h; Fig 5B). In lin-28(0) mutant animals, LIN-46 accumulated two stages earlier, at late L1, from 12 hours onwards. This was true regardless of whether the lin-46 5′UTR was mutated (Fig 5B and 5C). By contrast, and consistent with the RNA-seq data, in animals with the GGAG→CTCC mutation in the lin-46 5′UTR (lin-46(xe351xe347)), LIN-46 is detected at an intermediate time, in late L2 (from ~18 hours onwards), one stage earlier than in wild-type but one stage later than in lin-28(0) (Fig 5B). We noticed, but did not investigate further, that LIN-46 protein accumulates in the nucleus in lin-28(0) animals at ~26 hours (Fig 5B, white arrow).
Taken together, lin-46 repression is only partially dependent on the single GGAG motif within its 5′UTR. The fact that some repression remains in lin-46(++) animals and is still LIN28-dependent suggests either that LIN28 has an additional binding site in the lin-46 transcript, or that it additionally represses lin-46 through an indirect mechanism.
Enhanced expression of let-7 and lin-46 in two independent sensitized backgrounds emulates lin-28 mutant phenotypes
Since the manipulation of putative LIN28 binding sites achieved only a partial decoupling of lin-46 from LIN28-mediated regulation, insufficient to elicit heterochronic phenotypes (see below) and no decoupling of let-7, we performed further sufficiency testing in a sensitized genetic background. Specifically, LIN28 occurs in two isoforms, LIN28a and LIN28b, encoded in the same locus (Fig 1A). The two proteins share the C-terminal part containing the RNA-binding domains but differ in their N-terminal sequences encoded by isoform-specific first exons. A deletion of the LIN28b-specific first exon in a lin-28::flag::ha background results in the complete loss of detectable LIN28b protein (S6A Fig; lin-28(xe344xe59), henceforth referred to as lin-28(Δb)) and an intermediate upregulation of both let-7 miRNA and lin-46 mRNA throughout the examined time window (12–17 hours on food at 25 °C; S6B Fig). Despite these gene expression changes, the animals exhibit no signs of a protruding vulva (Fig 6A) or precocious alae synthesis (Fig 6B). However, in the luciferase assay, lin-28(Δb) animals exhibit a fully penetrant 4M* phenotype (i.e., a defect in pharyngeal cuticle shedding during the fourth molt; see above; Fig 6C and 6D).
Fig 6. Enhanced expression of let-7 and lin-46 is sufficient to induce lin-28 mutant-like phenotypes in a lin-28(Δb) background.
A: Quantification of the protruding vulva (Pvl) phenotype of adult animals of indicated genotypes. Animals were grown at 20 °C and examined at 52 h of development, when they had reached adulthood. N = 4 technical replicates, with n > 230 animals scored per genotype. Error bars represent standard deviation. Significant differences to wild type were determined by a Dunnett’s test (***p < 0.001). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). B: Quantification of the presence of alae in animals of indicated genotypes. Molting animals were singled and examined shortly after they exited the respective molt as indicated by ecdysis. The wild-type and lin-28(0) conditions are from Fig 3A and included for comparison. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). C: Quantification of the number of molts in animals of the indicated genotypes. The number at the bottom of each bar indicates the number of examined animals (n). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). D: Examples of luminescence intensity traces. Molt phenotypes are labeled as 3M for animals undergoing three molts, 4M for four molts, and 4M* for animals exhibiting an aberrant increase in luminescence intensity at the time of the expected fourth molt (indicated by a blue arrow). The two distinct outcomes of enhanced let-7 and lin-46 expression in the lin-28(Δb) background are illustrated. Note that in these animals, 4M involves a delayed and not properly executed fourth molt (4M), characterized by elevated luminescence intensity during this molt (arrowhead). Vertical blue bars indicate molts. The percentages indicate the penetrance of each phenotype (as shown in (C)). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). *: LIN28 is C-terminally FLAG::HA-tagged.
In the lin-28(Δb) background, we further enhanced the expression of let-7 and/or lin-46, by introducing an additional let-7 gene copy (hereafter let-7(++)), and by mutating the lin-46 5′UTR as in the lin-46(++) allele, respectively. Enhanced expression of lin-46 in the lin-28(Δb) background resulted in partially penetrant protruding vulva (71%) and precocious alae (47%) phenotypes (lin-28(Δb); lin-46(++) in Fig 6A and 6B). The penetrance of these phenotypes increased further when we additionally enhanced let-7 expression (from 71% to 87% and from 47% to 100%, respectively; lin-28(Δb); let-7(++) lin-46(++) in Fig 6A and 6B).
Upon individual enhanced expression of either let-7 or lin-46 in the lin-28(Δb) background, the animals still underwent the aberrant fourth molt characteristic of the 4M* phenotype (Fig 6C). However, when we jointly enhanced the expression of both genes in this background, 40% of animals failed to undergo a fourth molt entirely, while the remaining animals underwent three proper molts followed by an incomplete drop in the luminescence signal, possibly reflecting an aberrant molt (Fig 6C and 6D). We note that this latter molting pattern was distinct from the 4M* pattern, in which the signal steeply increases rather than decreases at the time of the expected fourth molt (Fig 6D). In repeat experiments, we observed an even higher frequency of animals undergoing only three molts, namely 63% (n = 27) and 67% (n = 45).
These findings were qualitatively recapitulated using a second sensitized background, lin-28::large_tag (S7 Fig). These animals look overtly wild-type, but, as noted also by others [45], GFP-tagging subtly impairs LIN28 function, causing an increase in let-7 miRNA levels comparable to lin-28(Δb) animals (S6B Fig).
LIN28 controls not only the number of larval stages but also their duration
C. elegans larval development is temporally segmented such that cells assume specific identities characteristic of a given larval stage [46]. Heterochronic genes were defined by their ability to specify these temporal fates, and their key role thus appears to be the maintenance of temporal order [4]. Other, clock-type mechanisms, involving oscillatory gene expression, are thought to set the tempo at which larval stages are executed [47, 48]. Surprisingly then, although lin-28(0) mutant animals execute only three instead of four larval stages, we found that the average duration from hatching to the exit from the final molt was comparable between wild-type and lin-28(0) animals (Fig 7A): the final, third molt in lin-28(0) animals occurs only shortly before the fourth molt in wild-type (Fig 7B). This is due to a substantial extension of larval stages in lin-28(0) animals, with the third larval stage being most strongly affected (Fig 7C). This extended L3 stage phenotype depends on the expression of both lin-46 and let-7 (Figs 7D and S8) and can be induced by their enhanced expression in sensitized genetic backgrounds with reduced LIN28 function (Fig 7E and 7F).
Fig 7. Lack of LIN28 results in extension of larval stage durations.
A: Quantification of total duration of larval development from hatching until exit from the last executed molt. Number of animals n = 36, 27 and 27 for wild type, lin-28(0) and lin-28(n719), respectively. The horizontal line represents the mean. Significant differences were determined by an unpaired two-sided t test (***p < 0.001; *p < 0.05). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). B: Average duration of developmental stages in wild-type, lin-28(0) and lin-28(n719) animals as determined by the luciferase assay (same experiment as shown in (A)). Rectangles indicate the molts, horizontal lines represent the intermolts. C: Quantification of larval stage durations of wild-type, lin-28(0) and lin-28(n719) animals (same experiment as shown in (A)). The horizontal line represents the median, hinges extend to first and third quartiles, and the whiskers extend up to the most extreme value within 1.5*IQR (interquartile range) of the median. Significant differences relative to wild type for each larval stage are indicated. P‐values were determined by a non‐parametric Wilcoxon rank sum test. ***p < 0.001. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). D: Quantification of the L3 stage duration of the same animals as in Fig 4B. The horizontal line represents the median, hinges extend to first and third quartiles, and the whiskers extend up to the most extreme value within 1.5*IQR (interquartile range) of the median. Significant differences were determined by a Dunn’s test with Holm correction for multiple testing. The statistical significance of selected comparisons is indicated (***p < 0.001; *p < 0.05; ns, not significant). For statistical significance of all comparisons, see S8 Fig. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). E: Quantification of the L3 stage duration of the same animals as in Fig 6C, examining the effects of lin-46 and let-7 expression modulation in a lin-28(∆b) mutant background. The horizontal line represents the median, hinges extend to first and third quartiles, and the whiskers extend up to the most extreme value within 1.5*IQR (interquartile range) of the median. Significant differences to wild type were determined by a Dunn’s test with Holm correction for multiple testing (***p < 0.001; no label, not significant). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). F: Quantification of the L3 stage duration of the same animals as in S7C Fig, examining the effects of lin-46 and let-7 expression modulation in a lin-28::large_tag background. The horizontal line represents the median, hinges extend to first and third quartiles, and the whiskers extend up to the most extreme value within 1.5*IQR (interquartile range) of the median. Significant differences to wild type were determined by a Dunn’s test with Holm correction for multiple testing (***p < 0.001; no label, not significant). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). *: LIN28 is C-terminally FLAG::HA-tagged.
In wild-type animals, the expression of thousands of genes is rhythmic, peaking once per larval stage (Fig 8A and 8B and [36, 37]). Consistent with the reduced number of molts accompanied by the gradually increasing extension of larval stages, oscillating genes peaked only three times in lin-28(0) animals over the course of the experiment (Fig 8A and 8B), with an increased period (Fig 8C and 8D).
Fig 8. Oscillatory gene expression reflects the perturbed molting cycle in lin-28(0) animals.
A: Heatmap showing mean-normalized log2-transformed expression levels of oscillating genes (n = 2,004; as defined in [37], with log2 amplitude ≥ 1 in that study) over time in wild-type (left) and lin-28(0) animals (right). Genes are ordered according to the published peak phase. B: Expression profile of a representative oscillating gene, lin-42, across development in wild-type and lin-28(0) animals. C: Distribution of instantaneous periods of all oscillating genes (n = 3,680) in wild-type and lin-28(0) animals. Color bar represents number of genes per bin at each time point. Average period is shown as a dashed line. The instantaneous period for each gene was computed using the Hilbert Transform on the data after processing it with a Butterworth filter. D: Comparison between the average periods replotted from (C). The shadowed area corresponds to the values between the 20th and 80th percentiles, from the distributions shown in (C). Data available at GEO under SuperSeries accession number GSE315957 (sample IDs GSM9440872 - GSM9440961).
Taken together, our findings show that LIN28 controls not only the identity of larval stages but also their duration. Whether this extends to other heterochronic genes and through what molecular mechanism remains to be elucidated.
Discussion
First discovered as a regulator of temporal patterning in C. elegans, LIN28 also plays various roles in humans, from acting as a pluripotency factor to controlling the onset of puberty. In various contexts, LIN28 proteins bind hundreds of transcripts, fitting the stereotype of RNA-binding proteins as promiscuous binders. However, here we have shown that in C. elegans, regulation of only two targets, let-7 and lin-46, is sufficient to explain the developmental function of LIN28. Previous studies had shown that individual mutation of let-7 or lin-46 could partially suppress lin-28 mutant precocious heterochronic phenotypes [20, 21, 23, 25]. Yet, the resulting double mutant animals did not recapitulate the retarded heterochronic phenotypes of let-7 or lin-46 loss, respectively, but instead exhibited an “in-between” phenotype. Such mutual suppression supported the existence of additional targets. We demonstrate here that lin-28; lin-46; let-7 triple null mutant animals recapitulate lin-46; let-7 double null mutant phenotypes. In other words, mutation of these two target genes is fully epistatic to mutation of lin-28.
While lin-46 and let-7 are both required for lin-28 precocious phenotypes related to molting and cuticle synthesis, lin-46 is the dominant factor for the protruding vulva phenotype and, not re-examined by us, the skipping of the L2-specific symmetric seam cell division, which is suppressed by loss of lin-46 [23] but not of let-7 [25]. This overall distinction agrees with the earlier proposal that LIN28’s function in regulating cell proliferation precedes later activities [25]. Furthermore, this may also explain why mutation of the lin-46 5′UTR, which advances LIN-46 accumulation by only one stage as opposed to two in lin-28 mutant animals, is insufficient for a Pvl phenotype. (We note that small deletions in the lin-46 5′UTR have been reported to induce a Pvl phenotype [22], but our data on one of these mutant strains suggest a contribution from additional factors in that strain’s background (see Methods).)
Interestingly, these findings also indicate that dysregulation of LIN-46 rather than let-7 appears to be the main driver of lin-28 mutant phenotypes, despite the extensive phylogenetic conservation of let-7 regulation by LIN28. In other words, early larval development is more robust to elevated levels of let-7 than of LIN-46. In contrast, not having enough let-7 later in development is lethal, whereas LIN-46 loss is well tolerated—possibly due to functional redundancies between LIN-46 and the let-7 sister miRNAs miR-48, miR-84 and miR-241 [38].
Despite the conservation of let-7 as a LIN28 target and the mechanism of its regulation, its mode of recognition in C. elegans remains to be elucidated. Whereas mammalian LIN28 recognizes a GGAG motif in the loop of pri- and pre-let-7 stem-loop structures [42–44], C. elegans let-7 lacks this motif. CLIP experiments instead suggested binding to the pri-let-7 outside the stem-loop structure [24], yet when we mutated the four implicated GGAG motifs, only minor, statistically insignificant changes in mature let-7 levels resulted, in contrast to the >50-fold upregulation observed upon LIN28 loss at the same early developmental stage. Similarly, mutation of the GGAG motif in the lin-46 5′UTR caused much weaker derepression than LIN28 loss. Given that binding of LIN28 to lin-46 was in fact detected mostly outside the 5′UTR [24], it seems possible that additional, redundant binding sites exist, and this may also be true for let-7. These binding sites might also be distinct from the canonical GGAG motif, as LIN28’s cold-shock domain is thought to promote transcript binding through a distinct GAU motif [42–44]. As this motif is likewise absent from both the apical part of the C. elegans pri-let-7 stem-loop and the lin-46 5′UTR, the mode of C. elegans LIN28 binding to its targets remains to be elaborated.
It had previously been speculated that LIN28 regulates lin-46 at the level of translation [22]. Nonetheless, we reproducibly observed increases in lin-46 mRNA levels in both animals with mutated lin-28 or mutated LIN28 bindings site in the lin-46 5′UTR. We suspect that the dynamic changes in lin-46 mRNA levels in wild-type animals might have obscured the effect of lin-28 loss in the earlier work. It also remains possible that, similar to the situation with miRNAs, lin-46 silencing involves both degradation and translational repression.
Our data do not formally rule out the possibility that LIN28 alters the activity of additional genes by translation or other mechanisms not captured by RNA-seq. Yet, if such regulation, not examined by us, exists, it appears largely inconsequential for the developmental functions that we have investigated here. Whether a similar scenario applies to mammalian LIN28 remains to be determined: regulatory roles were proposed for dozens of its bound transcripts [30], but experimental validation of the physiological relevance is limited for most of these interactions.
In addition to LIN28, several more RNA-binding proteins and miRNAs operate in the heterochronic pathway. Surprisingly, although miRNAs and RBPs are often considered to act inherently promiscuously, for the heterochronic pathway, a picture of great functional specificity is emerging: key factors, i.e., the lin-4 and let-7 miRNAs, the LIN-41 RBP and now also LIN28 all act through few (≤4) targets [5, 49–52]. This begs the question whether this is a unique feature of these particular factors and/or this particular pathway, or whether the possibility that RBPs and miRNAs act more specifically should be entertained also in other contexts. At least for miRNAs, more examples of uniquely relevant targets exist [53–57]. We do emphasize that greater specificity does not exclude the possibility of distinct targets in different contexts, and we envision a continuum, where some miRNAs (and RBPs) may have highly specific functions and others work more by a network-type mechanism. Nonetheless, pervasive RNA binding should not be taken at face value as an indicator of network activity, as high-throughput RBP-RNA binding data appear generally limited in their predictive power for functional interactions, likely due to a combination of technical limitations of available protocols and the capture of non-productive interactions [58–60].
Finally, although C. elegans heterochronic genes have thus far been viewed specifically as temporal patterning genes that determine the temporal identity of cells, and thereby the order of developmental events, we show here that LIN28 loss additionally causes a strong decrease in developmental tempo, most pronounced in L3. The developmental slowing occurs rather uniformly across animals and rhythmic gene expression patterns remain robustly detectable at the population level, pointing to a specific effect rather than a mere deterioration of developmental robustness – a notion further supported by the fact that the additional loss of let-7 and lin-46 reverts developmental tempo to wild-type levels.
The clock that controls developmental tempo was previously shown to slow down during the L4 stage, while maintaining a constant amplitude of periodic gene expression, before ultimately settling into a stable, non-oscillatory regime as animals reach adulthood [37]. Hence, a parsimonious explanation of the reduced developmental tempo in lin-28 mutant animals is that loss of LIN28 pushes the system precociously towards the bifurcation point that separates the oscillatory from the non-oscillatory regime, without immediately crossing it. Clearly, the heterochronic pathway and the developmental clock are interconnected in numerous and complex ways that await further dissection in the future.
Limitations of the study
The RIP-seq method that we used to identify mRNAs bound by LIN28 may also identify non-physiological binding partners, that emerged from post-lysis associations. However, since the overlap to previously published CLIP-seq data [24] was substantial and significant, and lin-46, the only dysregulated gene, was also LIN28-bound, false positive binding events are not expected to impact the key conclusions.
As we were unable to effectively uncouple let-7 and lin-46 from regulation by LIN28, we had to rely on a sensitized background for sufficiency testing. Although similar results were obtained with two different sensitized backgrounds, it remains possible that this sensitization involves upregulation of additional LIN28 targets not captured by mRNA-seq. Future work, achieving complete decoupling of the two targets from LIN28-mediated repression without perturbation of lin-28 itself, will be able to rule in or out this possibility. Irrespectively, when viewed together with the analysis of the suppression analysis, it is evident that lin-46 and let-7 are the functionally essential LIN28 targets.
Materials and methods
C. elegans handling
The wild-type strain used in this study was Bristol N2. Transgenic strains used in this study are listed in S1 Table. To synchronize animals, arrested L1 stage larvae were obtained by extracting embryos from gravid adults using a bleaching solution (30% (v/v) sodium hypochlorite 4%–6% reagent (Sigma-Aldrich; 419550010), 750 mM KOH) and hatching overnight in the absence of food, at room temperature in M9 buffer (42 mM Na2HPO4, 22 mM KH2PO4, 86 mM NaCl, 1 mM MgSO4). Experiments were performed at 25 °C unless explicitly stated otherwise.
Generation of transgenic CRISPR strains
Alleles generated in this study are listed in S2 Table. Sequences of oligos used for CRISPR strain generation are listed in S3 Table.
The let-7(xe150) and lin-28(xe192) alleles were generated following an adapted “dpy-10 conversion protocol” [61, 62]. sgRNAs were cloned into a NotI-digested pIK198 plasmid using Gibson cloning. The injection mix contained: 50 ng/μl pIK155 (Cas9 expression vector), 100 ng/μl pIK208 (sgRNA expression vector targeting dpy-10), 20 ng/μl AF-ZF-827 (homology repair oligo for dpy-10) and 100 ng/μl of each pIK198 with a cloned sgRNA targeting the gene of interest.
The let-7(xe336), lin-28(xe344xe59), lin-46(xe347), lin-46(xe351xe347), lin-46(xe370) and lin-28(xe197) alleles were generated following published protocols [63, 64]. crRNAs targeting the genes of interest were ordered from IDT (Alt-R CRISPR-Cas9 crRNA, 2 nmol, standard desalting). A pre-injection mix with 0.5 μl Alt-R S.p. Cas9 Nuclease V3 (10 μg/μl; IDT, 1081058), 5 μl tracrRNA (0.4 μg/μl; IDT) and 2.8 μl crRNA (0.4 μg/μl) (or 1.4 μl of each crRNA if two were used) was incubated for 15 min at 37 °C before adding 2 μl pGH8 (100 ng/μl), 2 μl pRF4 (400 ng/μl) and either 500 ng of melted dsDNA donor or 2.2 μl single-stranded oligo donor (1 μg/μl; ordered as 4 nmole Ultramer DNA Oligo Standard Desalting from IDT).
To test whether LIN28-mediated lin-46 repression depends on the single GGAG motif present in lin-46 5′UTR, we changed it from GGAG to CTCC, generating the lin-46(xe370) allele. lin-46(xe370) animals did not exhibit a protruding vulva phenotype (Results) unlike other lin-46 5′UTR mutant lines previously described [22]. To address whether these differences reflected differences in the mutation or strain background, as the previously reported lines also contained the maIs105 [col-19p::gfp] V multicopy array integrated in the same chromosome as lin-46, we sought to outcross the maIs105 array from the lin-46(ma467) allele, a 12 nucleotide long deletion removing the first two G’s of the GGAG motif and 10 nucleotides upstream (strain VT3855) [22]. Despite screening over 300 F2 progeny from three separate outcross attempts, we did not detect any recombination events between the two loci. As an alternative approach, we introduced a deletion identical to ma467 in either wild-type or lin-46::3xflag::gfp11 backgrounds using CRISPR/Cas9. This did not cause precocious LIN-46 accumulation or a protruding vulva phenotype, and the maIs105 array could readily be crossed into that strain, suggesting that the inability to cross maIs105 out of VT3855 is not due to a small genetic distance to lin-46(ma467) or crossover suppression but due to some other strain background effect. As we will detail elsewhere, genome resequencing revealed the existence of a ~7.6-kb deletion near lin-46 in VT3855. Hence, we conclude that strain VT3855 in addition to ma467 has several aberrations from the wild type N2 so that the Pvl phenotype cannot be confidently attributed to ma467.
Experiments to quantify gene expression
To quantify gene expression using sequencing techniques or RT-qPCR, animals were sampled either hourly over a developmental timecourse (denoted as “TC” in S4 Table), or only at selected time points (denoted as “Exp” in S4 Table). Samples were collected as described below. Prior to RNA extraction, animals were lysed by five cycles of thawing (42 °C) and snap-freezing in liquid nitrogen. RNA was extracted either using Direct-zol RNA Microprep kit (Zymo Research; R2062; DNase treatment included) according to the manufacturer’s protocol or performing phenol-chloroform extraction according to the Tri Reagent (Molecular Research Center, TR-118) manufacturer’s protocol followed by DNase treatment (RNase-Free DNase I kit (#25710 NORGEN); Single Cell RNA Purification Kit (#51800 NORGEN)).
Sample collection: Animals grown on plates.
Synchronized L1 animals were plated on 2% NGM plates seeded with OP50 E. coli bacteria and grown at 25 °C. At the time of sample collection (S4 Table), animals were washed off the plates with M9 buffer, washed twice with M9 buffer, resuspended in TRI Reagent and snap-frozen in liquid nitrogen.
Sample collection: Animals grown in liquid culture.
For the full developmental timecourse (TC2), synchronized L1s were grown in liquid culture (S-Basal supplemented with OP50; OD600 = 2.7; 1,000 animals/ml) at 25 °C shaking at 180 rpm. Animals were sampled hourly, washed three times with M9 buffer, resuspended in TRI Reagent and snap-frozen in liquid nitrogen.
TaqMan RT-qPCR: Quantification of mature let-7 miRNA.
To quantify the levels of mature let-7 miRNA, 20 ng of total RNA was reverse transcribed using TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific; 4366596) and the following TaqMan MicroRNA Assays (Thermo Fisher Scientific): mature let-7 (ID 000377), sn2841 (reference gene; ID 001759). The reverse transcription (RT) reaction of total volume 15 μl contained 0.75 μl of each RT primer (for let-7 and sn2841) and was incubated at 16 °C for 30 min, 42 °C for 30 min and 85 °C for 5 min. The resulting cDNA was used as template for qPCR. qPCR was performed either in Step one Realtime PCR (Thermo Fisher Scientific) or Roche LightCycler 480 machine depending on the number of reactions. A qPCR reaction contained TaqMan 2× Universal PCR Master Mix, no Amp Erase (Thermo Fisher Scientific; 4324018) and the above-listed TaqMan MicroRNA Assays. The PCR conditions were initiated with 10 min incubation at 95 °C, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. Average Ct values were obtained from three technical replicates for each condition. Delta Ct (dCt) was calculated by subtracting Ct values of sn2841 from let-7 miRNA Ct values. Expression levels were normalized to a reference sample and plotted as −ddCt, where −ddCt = − (dCt − dCtreference). The N2 sample of each biological replicate (S3B and S3D Fig) and the N2 12 h sample (S6B Fig) were used as reference samples. P-values were determined by a paired two-sided t test.
RT-qPCR: Quantification of lin-46 mRNA and primary let-7 transcript levels.
300 ng of total RNA was reverse transcribed to cDNA using the ImProm-II Reverse Transcription System (Promega; A3800) and oligo(dT) primers according to the manufacturer’s protocol. RT-qPCR reactions were performed using PowerUp SYBR Green Master Mix (Applied Biosystems; A25776) in Roche LightCycler 480 machine. Average Ct values were obtained from three technical replicates for each condition. Delta Ct (dCt) was calculated by subtracting Ct values of actin from lin-46 or primary let-7 Ct values. For lin-46, expression levels were normalized to the wild-type 12 h sample (= reference sample) and plotted as −ddCt, where −ddCt = − (dCt − dCtreference) (S6B Fig). For primary let-7, Ct values were set to 40 if not determined by the qPCR machine and expression levels were normalized to wild-type sample at each time point and plotted as 2−ddCt (S3C Fig).
mRNA-seq.
RNA integrity was validated using either RNA Nano Chip with Agilent 2100 Bioanalyzer or RNA ScreenTape with Agilent TapeStation. The quality control of the sequencing libraries was performed using High Sensitivity DNA Assay with Agilent 2100 Bioanalyzer.
mRNA-seq: DEG in lin-28(0) versus wild type.
Sequencing reads were mapped to the C. elegans reference genome (ce11) with the R package QuasR [65] using the spliced alignment algorithm HISAT2. Protein-coding exons were defined based on the exon annotation file from WormBase (WS270) and read mappings to the corresponding genes were counted using qCount function from the QuasR package. To determine differentially expressed genes in lin-28(0) animals relative to wild type, three biological replicates of a developmental time window of 3–6 h were analyzed (TC2, TC3 and TC4; Fig 1C). Read counts for each sample were pooled across the four time points (3 h, 4 h, 5 h and 6 h) and then normalized to the mean mapped library size, where ‘library size’ refers to the total number of mapped reads of the pooled libraries. The normalized counts were log2-transformed with a pseudocount of 8. Differentially expressed genes were identified using the R package edgeR, applying batch correction for biological replicates. Genes with low expression were filtered out using filterByExpr. Quasi-likelihood F-tests were performed to assess differential expression, and genes with a false discovery rate (FDR) < 0.01 were considered significantly differentially expressed.
mRNA-seq: Spectral analysis.
The dynamics of each previously defined oscillating gene [37] (n = 3,680), was processed using the Python (3.11) implementation of the Butterworth filter in the Scipy package (version 1.16.0, functions butter, sosfiltfilt and hilbert from the signal module). A first-order bandpass filter was used, with critical frequencies of (0.07, 0.14) for the control and (0.06, 0.12) for the mutant strain. These frequencies were chosen empirically to span an octave that would contain most of the spectra, accounting for the longer period of the lin-28(0) strain.
The analytic signal of each preprocessed gene was then computed using the Hilbert Transform. The instantaneous phase can be computed as the argument of the analytic signal. The instantaneous frequency was computed by differentiating numerically the unwrapped instantaneous phase (functions angle, unwrap and diff from the Numpy library, version 2.3.1). The instantaneous period is the reciprocal of the instantaneous frequency. The distribution of instantaneous periods was computed for each time point for the whole set of oscillating genes in each condition.
Small RNA-seq.
RNA integrity was validated using RNA Nano Chip with Agilent 2100 Bioanalyzer and sequencing libraries were generated using CleanTag Small RNA Library Preparation Kit (Trilink) according to the manufacturer’s instructions. The library was sequenced on Illumina HiSeq2500, as 50 cycles single-end reads. The small RNA-seq fastq files were adapter trimmed (TGGAATTCTCGGGTGCCAAGG) at the 3′ end using the function preprocessReads() from the QuasR package. Sequencing reads were mapped to the C. elegans genome (ce10) using the qAlign() function from the QuasR package. For miRNA quantification, gene annotations from miRBase v22 were used. We extended the genomic coordinates by ±3 bp (upstream and downstream) of the 5′ end of each miRNA and counted all the reads that started within those regions. Read counts were normalized to the mean mapped library size and the normalized values were then log2-transformed with a pseudocount of 8. The data obtained from this timecourse (TC2) were used to generate the expression profiles of different miRNAs in Figs 1F and S2.
To determine differentially expressed miRNAs in lin-28(0) animals (Fig 1G), we used a published small RNA seq dataset [33]. In this dataset, a part (0–23 h) of the long developmental timecourse TC2 was resequenced for deeper coverage and the sequencing reads were combined with the reads from the whole timecourse sequencing and further processed as described in Nahar and colleagues [33]. Differentially expressed miRNAs were identified using the R package edgeR, treating time points 3–6 h as pseudoreplicates, with batch correction applied for time points. miRNAs with low expression were filtered out using filterByExpr. Quasi-likelihood F-tests were performed to assess differential expression, and miRNAs with a FDR < 0.01 were considered significantly differentially expressed.
LIN28 RNA-immunoprecipitation followed by sequencing (RIP-seq)
Sample collection and lysis.
The experiment was performed with non-transgenic wild-type animals (N2; control) and lin-28::large_tag animals (HW2805). Approximately 4.5 million of synchronized L1s of each genotype were plated on peptone-enriched 2% NGM agar XL plates seeded with E. coli OP50 bacteria (~500,000 L1s per plate) and grown for 6 hours at 25 °C. Animals were harvested, washed three times with 10 ml M9 buffer, washed once with 8 ml of 0.1 M KCl, resuspended in ~1.5 ml of 0.1 M KCl and transferred to a 1.5-ml Eppendorf tube. Samples were spun down, the remaining liquid was aspirated and dry pellets were snap-frozen in liquid nitrogen. Upon thawing, animal pellets were lysed in an approximately equal volume of extraction buffer (50 mM HEPES/KOH (pH 7.4 at 4 °C), 150 mM KCl, 5 mM MgCl2, 0.1% (v/v) Triton X-100, 10% (w/v) glycerol, 1 mM PMSF, 1 tablet/10 ml cOmplete Mini Protease Inhibitor Tablets (EDTA-free; Roche, 11836170001), 200 U/ml RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, 10777019)), with mortar and pestle in the presence of liquid nitrogen. Lysates were cleared by centrifugation at 12,000g for 20 min at 4 °C. The supernatant was transferred to a fresh Eppendorf tube and kept on ice.
RNA-Immunoprecipitation (RIP).
Total protein concentration was measured using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Cat. no. 23225 and 23227). Anti-GFP IPs were performed by incubating 3 mg total protein with 50 μl of Dynabeads Protein G (Thermo Fisher Scientific, 10003D) bound to anti-GFP antibody (5 μg/IP; Abcam, ab290) in a total volume of 1 ml for 3 hours at 4 °C on a rotating wheel. Beads were washed five times for five minutes in 1 ml of extraction buffer without protease and RNase inhibitors, before extracting the bound RNA by directly adding TRI Reagent to the beads and snap-freezing in liquid nitrogen. For each condition, three IPs were performed in parallel as technical replicates. Three aliquots of input lysate each corresponding to 100 μg total protein were snap-frozen in liquid nitrogen upon addition of TRI Reagent for extraction of the input RNA.
RNA extraction and sequencing.
Upon thawing, samples were incubated at room temperature for 10 min shaking at 300 rpm before transferring the supernatant without the beads to a new Eppendorf tube. RNA was extracted using Direct-zol RNA Microprep kit (Zymo Research; R2062) according to the manufacturer’s protocol including the on-column DNase digestion. RNA integrity was validated using RNA Nano Chip with Agilent 2100 Bioanalyzer and sequencing libraries were generated using Illumina Stranded mRNA-seq protocol. The library was sequenced using NovaSP, 50 cycles pair-end reads.
RIP-seq analysis.
Sequencing reads were mapped to the C. elegans reference genome (ce11) with the R package QuasR using the spliced alignment algorithm HISAT2 [65]. Protein-coding exons were defined based on the exon annotation file from WormBase (WS270) and read mappings to the corresponding genes were counted using qCount function from the QuasR package.
To determine differentially enriched mRNAs in LIN28 IP relative to untagged control (N2) IP (Fig 1B), we used the R package edgeR. Genes with low expression were filtered out using filterByExpr. Quasi-likelihood F-tests were performed to assess differential enrichment, and genes with a FDR < 0.01 were considered significantly differentially enriched.
To examine whether pri-let-7 is enriched in LIN28 IP relative to untagged control (N2) IP (Fig 1E), pri-let-7 locus was defined with genome coordinates using the GRange function (GRanges(seqnames = Rle(“chrX”),ranges = IRanges(14743780, end = 14744173),strand=”-”)), starting right downstream of the pre-let-7 stem-loop up until the C05G5.7 coding sequence. Reads mapping to this region were counted using qCount function from the QuasR package and the counts were normalized to the mean mapped library size. The normalized values were then log2-transformed with a pseudocount of 1. The statistical significance of differences in pri-let-7 enrichment between the averages of the two input samples and the averages between the two IP samples was assessed using an unpaired two-sided t test.
Luciferase assay
To assess the molting cycle progression of individual animals, we employed a luciferase assay as described previously [37, 39]. Gravid adults were bleached and single embryos expressing luciferase from a constitutive and ubiquitous promoter (transgene xeSi312) were transferred by pipetting to a white, flat-bottom, 384-well plate (Berthold Technologies, 32505). Embryos were allowed to develop in 90 μl S-Basal medium containing E. coli OP50 bacteria (OD600 = 1) and 100 μM Firefly D-Luciferin (p.j.k., 102111). Plates were sealed with Breathe Easier sealing membrane (Diversified Biotech, BERM‐2000). Luminescence was measured every 10 min for 0.5 s for a total duration of 52–96 h (depending on the purpose of the experiment) using a luminometer (Berthold Technologies, Centro XS3 LB 960). The luminometer was placed in a temperature-controlled incubator set to 18.5 °C, which translated to an effective temperature of 22.5 °C experienced by the animals inside the luminometer.
Luminescence intensity traces of individual animals were further analyzed using a Python-based custom code (L.J.M.M., unpublished, code available at https://doi.org/10.5281/zenodo.20742641). Hatch, as well as both molt entries and exits, were automatically annotated using a small convolutional neural network and further refined manually. Molts were defined as periods of stable low signal, preceded and followed by a sudden drop and rise in luminescence intensity, respectively. Significant differences in total durations of larval development (Fig 7A) were determined by an unpaired two-sided t test. P-values of all pair-wise comparisons of L3 durations were determined by a non-parametric Dunn’s test with Holm correction for multiple testing (Figs 7D, 7E, 7F, and S8).
Examination of balanced animals carrying the lethal let-7(xe150) allele
Several strains examined in this work (S1 Table) carry the lethal let-7(xe150) allele, which causes vulva bursting shortly after exit from the fourth molt. To maintain these strains, they were balanced with an extrachromosomal array [51], which contains a let-7 transgene and several mCherry reporters (xeEx365[let-7p::let-7::SL1_operon_GFP, unc-119(+), rab-3p::mCherry, myo-2p::mCherry, myo-3p::mCherry]). This array segregates randomly during meiosis, resulting in incomplete inheritance, with only a subset of progeny carrying the array and thus surviving into adulthood. In order to examine the molting cycle of animals with lethal genotypes, animals were retrieved from the luciferase assay plate after the assay was finished. They were visually inspected for the presence of the mCherry-marked balancer array using a fluorescent binocular microscope and only the luminescence intensity traces of animals not carrying the balancer array were included in the analysis.
Examination of the 4M* phenotype in lin-28(0); lin-46(0) animals
To examine the partially penetrant and liquid culture-specific aberrant fourth molt phenotype of lin-28(0); lin-46(0) animals (HW3504), synchronized L1s were loaded to the luciferase assay plate. The reason for using synchronized L1s instead of embryos was to achieve a synchronously developing population to enrich for animals at the desired developmental stage at the time of examination. The luciferase assay was run for 52 hours. Afterwards, the luminescence intensity traces of individual animals were examined and classified into two groups—animals that underwent a normal fourth molt and animals that exhibited the 4M* phenotype (a steep increase in luminescence intensity instead of the typical signal drop at the time of the expected fourth molt). Fifteen animals from each group were retrieved from the plate, mounted onto two separate 2% (w/v) agarose pads and immobilized in 10 mM levamisole. Differential Interference Contrast (DIC) images were acquired with a Zeiss Axio Observer Z1 microscope using the Zen 2 software. Selections of regions and image processing were performed with Fiji [66].
Confocal imaging
To assess the time of LIN-46 protein accumulation, animals were grown on 2% NGM agar OP50 plates at 25 °C for the indicated time before mounted on a 2% (w/v) agarose pad with a drop of 10 mM levamisole solution. Animals were imaged on an upright microscope Axio Imager M2 (Zeiss) equipped with CSU W1 with Dual T2 spinning disk confocal scanning unit (Yokogawa) driven by Visiview 6.0 (Visitron). DIC and fluorescent images were acquired with a 40×/1.3 oil immersion objective (EC Plan Neofluar). Using the Fiji software, images were processed after selecting representative regions.
Western blotting
Synchronized L1s were plated on 10 cm 2% NGM agar OP50 plates, grown at 25 °C and harvested at 3 and 6 h (20,000 animals per time point) in M9 buffer, washed twice with M9 buffer, resuspended in ~1 ml of 0.01% Tween-20 (Sigma-Aldrich, P9416) in M9 buffer and transferred to 1.5 ml Eppendorf tubes. Samples were spun down and dry pellets were snap-frozen in liquid nitrogen. Lysates were prepared by boiling (5 min, 95 °C) and sonication (Bioruptor Plus, 13 cycles, 30 s on/60 s off at 4 °C) in SDS lysis buffer (63 mM Tris-HCl (pH 6.8), 5 mM DTT, 2% SDS, 5% sucrose) and cleared by centrifugation. Proteins were separated by SDS-PAGE on a 4%–12% Bis-Tris gel (Thermo Fisher Scientific, NP0335BOX) in MOPS running buffer (Thermo Fisher Scientific, NP0001). Samples were run at 80 V for ~30 min and then at 150 V until the desired protein separation was achieved. Forty micrograms of protein extract was loaded per well and PageRuler Prestained Protein Ladder (10–180 kDa; Thermo Fisher Scientific, 26616) was used as a molecular weight reference. Proteins were transferred to a PVDF membrane (Bio-Rad, 1620177) by semi-dry blotting at 20 V for 1 hour (transfer buffer: 250 mM Tris, 1.9 M glycine, 0.5% SDS + 20% methanol). The membrane was blocked with 5% (w/v) milk in TBST (0.1% Tween-20 in TBS) for 1 h shaking (150 rpm). LIN28 was detected using polyclonal rabbit anti-LIN28 antibody (custom-made by GenScript, R13880; raised against full-length recombinant His6::TEV::LIN28a; 1:1,000), followed by polyclonal anti-rabbit HRP-conjugated antibody (Santa Cruz Biotechnology, sc-2004; 1:5,000). Antibodies were diluted in 0.5% (w/v) milk in TBST and incubated with the membrane for 1 h shaking at 150 rpm at room temperature. ECL Detection Reagent (Cytiva, RPN2232) and Amersham Imager 680 were used for detection. After LIN28 detection, the membrane was stripped (Restore PLUS Western Blot Stripping Buffer; Thermo Fisher Scientific, 46430), washed with TBST, blocked as described above and incubated with monoclonal mouse anti-Actin, clone C4 (MilliporeSigma, MAB1501; 1:7,500) and anti-mouse HRP-conjugated antibody (Cytiva, NXA931; 1:5,000) in 0.5% (w/v) milk in TBST for 1 h shaking at 150 rpm at room temperature, followed by Actin detection as described above.
Examination of precocious alae phenotypes upon molt exit
To assess the presence of alae, synchronized L1s of indicated genotypes were grown on 2% NGM agar OP50 plates at either 20 or 25 °C and inspected with a binocular microscope. When ~50% of the animals entered the respective molt (S5 Table), as indicated by the lack of movement and pharynx pumping, ~35 animals were individually transferred to small plates and inspected at regular intervals (every ~20 min) for signs of molt completion, as indicated by resumed movement, pharynx pumping and the presence of the old shed cuticle on the plate. The first 10 animals that exited the molt were mounted onto a 2% (w/v) agarose pad, immobilized in 10 mM levamisole and the phenotypes were examined. Afterwards, 10 more animals that exited the molt in the meantime were processed in the same way. DIC images were acquired with a Zeiss Axio Observer Z1 microscope using the Zen 2 software. Selections of regions and image processing were performed with Fiji.
Quantification of the protruding vulva phenotype
Synchronized L1s were plated on 2% NGM agar OP50 plates and grown at 20 °C for 52 h, before animals exhibiting either normal or protruding vulva were counted using a binocular microscope. Four plates per condition were examined (N = 4), with > 230 animals scored per condition. Significant differences to wild type were determined by a Dunnett’s test.
Quantification of the vulva bursting phenotype
Synchronized L1s were plated on 2% NGM agar OP50 plates and grown at 25 °C for 48 h, before animals exhibiting either normal or burst vulva were counted using a binocular microscope. Three plates per condition were examined (N = 3), with 240 animals scored per condition (n = 240).
Supporting information
S1 Fig. Gene expression profiles of lin-28(n719) and lin-28(xe192) differ substantially.
A: Scatterplot depicting log2 fold changes in gene expression for each lin-28 mutant relative to wild type. Expression was quantified by RNA-seq of synchronized animals collected hourly from 3 to 6 h at 25 °C, with the average expression values across the four time points being shown. Independent biological replicates of the wild-type sample were used for the two comparisons. To highlight differences in global gene expression profiles, genes upregulated ≥4-fold in lin-28(n719) but ≤4-fold in lin-28(xe192) are labeled in blue. lin-28, lin-46 and F02E9.3 are labeled for reference. Note that lin-28(n719) was obtained by crossing it out of a lin-28(n719); let-7(mn112) unc-3(e151) strain [20] using N2 wild-type animals. The changes in gene expression levels caused by the two lin-28 alleles differ substantially, with only a handful of genes dysregulated in both backgrounds, including a previously validated LIN28 target, lin-46 [23]. Moreover, while lin-28 mRNA is undetectable in lin-28(xe192) animals, its levels are only modestly reduced in lin-28(n719) relative to wild-type animals. Upon a closer inspection of the mapped sequencing reads, we noticed that in lin-28(n719) animals, an alternative splice site positioned 17 nucleotides upstream of the mutated one is used to splice the second and the third exon together, producing a lin-28 transcript harboring an in-frame stop codon. Strikingly, despite the substantial differences in their gene expression profiles, both lin-28 mutations cause identical phenotypes, suggesting that the genes whose dysregulation causes the phenotypes are among the few affected by both lin-28 alleles. Data available at GEO under SuperSeries accession number GSE315957 (sample IDs GSM9440844 - GSM9440859). B: Scatterplot comparing mRNA expression levels in two independent wild-type replicates from S1A Fig. Expression was quantified by RNA-seq of synchronized animals collected hourly from 3 to 6 h at 25 °C, with the average expression values across the four time points being shown. Independent biological replicates of the wild-type sample were used for the two comparisons. Data available at GEO under SuperSeries accession number GSE315957 (sample IDs GSM9440844 - GSM9440859).
https://doi.org/10.1371/journal.pbio.3003892.s001
(PDF)
S2 Fig. Developmental expression profiles of miRNAs in wild-type and lin-28(0) animals.
Levels of mature miRNAs in wild-type and lin-28(0) animals as determined by small RNA-seq. The two dashed lines indicate the window of time points pooled for differential gene expression analysis in Fig 1G. Data available at GEO under SuperSeries accession number GSE315957 (sample IDs GSM9441669 - GSM9441710) and GSE245904 (sample IDs GSM7850636 - GSM7850683).
https://doi.org/10.1371/journal.pbio.3003892.s002
(PDF)
S3 Fig. let-7 alleles generated in this study.
A: Schematic representation of the let-7 genomic region depicting two isoforms of the let-7 primary transcript, pri-let-7a and pri-let-7b. Both isoforms undergo trans-splicing to spliced leader 1 RNA (SL1; shown in green), which is required for their further processing into mature let-7 [67]. The blue horizontal bar represents a putative LIN28 binding site [24]. The hairpin structure indicates the position of the pre-let-7 hairpin within the primary transcripts, with the mature let-7 guide strand highlighted in red. Mutant alleles used in this study are indicated: xe150 is a deletion, while xe336 carries mutations converting the four GGAG motifs within the putative LIN28 binding site to CTCC. B: Mature let-7 levels were measured by TaqMan RT-qPCR in wild-type (N2) and let-7(xe150) animals at 30 h and 33 h of development at 25 °C, when let-7 levels are at their peak in wild-type animals [33]. Expression levels at each time point were first normalized to the levels of small nucleolar RNA sn2841 (reference gene) and then to the wild-type sample. Bars indicate the mean of three biological replicates. P-values were determined by a paired two-sided t test. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). C: Expression levels of primary let-7 measured by RT-qPCR in wild-type (N2) and let-7(xe150) animals at 30 h and 33 h of development at 25 °C, when mature let-7 levels are at their peak in wild-type animals [33]. Expression levels at each time point were first normalized to the levels of a reference gene (act-1). Bars indicate the mean of two examined time points. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). D: Mature let-7 levels were measured by TaqMan RT-qPCR at 12 h and 15 h of development at 25 °C, when LIN28 represses let-7 processing in wild-type animals. Expression levels at each time point were first normalized to the levels of small nucleolar RNA sn2841 (reference gene) and then to the wild-type sample. Bars indicate the mean of three biological replicates. P-values were determined by a paired two-sided t test. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133).
https://doi.org/10.1371/journal.pbio.3003892.s003
(PDF)
S5 Fig. Spatial expression pattern of lin-46 in wild-type L4 animals.
Confocal images of endogenously split-GFP-tagged LIN-46 in the developing vulva (left), rectum (middle) and tail (right) of wild-type animals at 26 hours of development at 25 °C. Scale bars: 10 μm.
https://doi.org/10.1371/journal.pbio.3003892.s005
(PDF)
S6 Fig. Generation of lin-28(∆b) isoform-specific mutant.
A: Deletion of isoform-specific lin-28 exons results in the loss of the respective protein isoform. Western blot showing the levels of both LIN28 isoforms, with size differences due to varying tag sizes in different genetic backgrounds. The LIN28a band is absent in lin-28(Δa) animals, whereas the LIN28b band is absent in lin-28(Δb) animals, validating the successful generation of isoform-specific mutants. Note that lin-28(∆a) is not further analyzed in this study. As an antibody specificity control, lin-28(0) animals, which lack LIN28 protein, were included. Animals were grown at 25 °C and collected at 3 and 6 h of development. Protein lysates were probed using anti-LIN28 and anti-actin antibodies. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). *: LIN28 is C-terminally FLAG::HA-tagged. B: Expression levels of mature let-7 miRNA (left) and lin-46 mRNA (right) measured by RT-qPCR in animals grown at 25 °C and collected hourly from 12 to 17 hours of development. Expression levels at each time point were first normalized to the levels of a reference gene (small nucleolar RNA sn2841 for let-7, actin mRNA for lin-46) and then to wild type at 12 h. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). *: LIN28 is C-terminally FLAG::HA-tagged.
https://doi.org/10.1371/journal.pbio.3003892.s006
(PDF)
S7 Fig. Enhanced expression of let-7 and lin-46 is sufficient to induce lin-28 mutant-like phenotypes in lin-28::large_tag background.
A: Quantification of the protruding vulva (Pvl) phenotype of adult animals of indicated genotypes. Animals were grown at 20 °C and examined at 54 h of development. N = 4 technical replicates, with n > 170 animals scored per genotype. Error bars represent standard deviation. Significant differences to wild type were determined by a Dunnett’s test (ns: not significant; ***p < 0.001). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). B: Quantification of the presence of alae in animals of indicated genotypes. Molting animals were singled and examined shortly after they exited the respective molt as indicated by ecdysis. The wild type, lin-28(0), let-7(++), lin-46(++) and let-7(++) lin-46(++) conditions are replotted from Fig 6B. Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). C: Quantification of the number of molts in animals of the indicated genotypes. The number at the bottom of each bar indicates the number of examined animals (n). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133). D: Examples of luminescence intensity traces. Molt phenotypes are labeled as 3M for animals undergoing three molts, 4M for four molts, and 4M* for animals exhibiting an aberrant increase in luminescence intensity at the time of the expected fourth molt (indicated by a blue arrow). The two distinct outcomes of enhanced expression of both let-7 and lin-46 in the lin-28::large_tag background are illustrated. Vertical blue bars indicate molts. The percentages indicate the penetrance of each phenotype (as shown in (C)). Raw data available on Zenodo (https://doi.org/10.5281/zenodo.20787133).
https://doi.org/10.1371/journal.pbio.3003892.s007
(PDF)
S2 Table. Alleles generated in this work.
A list of alleles generated in this study, including the information on the deleted or mutated sequence in each allele, the sgRNA or crRNA used to generate the allele, the homology repair donor (where applicable), the injected strain and the protocol used.
https://doi.org/10.1371/journal.pbio.3003892.s011
(XLSX)
S4 Table. Overview of experiments assessing gene expression levels.
A list of experiments assessing gene expression levels, including the strains used, culture conditions (plates or liquid culture), RNA extraction method and gene expression quantification method.
https://doi.org/10.1371/journal.pbio.3003892.s013
(XLSX)
S5 Table. Time at which molting animals were singled during alae quantification experiments.
To assess the presence of alae upon molt exit, animals were individually transferred to small plates while undergoing the indicated molt. The times at which animals of the indicated genotypes were singled are summarized in this table. Related to Figs 3A, 3B, 6B, S4 and S7B.
https://doi.org/10.1371/journal.pbio.3003892.s014
(XLSX)
Acknowledgments
We thank Benjamin Towbin, Rajani Gudipati and Julien Orgül for generating strains used in this study, Iskra Katic for microinjections, Sandra Mühlhäusser for producing recombinant LIN28 for antibody production, Victor Ambros for providing strains, Alex Smith for statistical analysis support and Chiara Azzi for experimental support. We thank Marc Bühler and Iskra Katic for their comments on the manuscript.
References
- 1. Faunes F, Larraín J. Conservation in the involvement of heterochronic genes and hormones during developmental transitions. Dev Biol. 2016;416(1):3–17. pmid:27297887
- 2. Moss EG, Romer-Seibert J. Cell-intrinsic timing in animal development. Wiley Interdiscip Rev Dev Biol. 2014;3(5):365–77. pmid:25124757
- 3. Tena-Sempere M. Keeping puberty on time: novel signals and mechanisms involved. Curr Top Dev Biol. 2013;105:299–329. pmid:23962847
- 4. Ambros V, Horvitz HR. Heterochronic mutants of the nematode Caenorhabditis elegans. Science. 1984;226(4673):409–16. pmid:6494891
- 5. Moss EG, Lee RC, Ambros V. The cold shock domain protein LIN-28 controls developmental timing in C. elegans and is regulated by the lin-4 RNA. Cell. 1997;88(5):637–46. pmid:9054503
- 6. Ong KK, Elks CE, Li S, Zhao JH, Luan J, Andersen LB, et al. Genetic variation in LIN28B is associated with the timing of puberty. Nat Genet. 2009;41(6):729–33. pmid:19448623
- 7. Perry JRB, Stolk L, Franceschini N, Lunetta KL, Zhai G, McArdle PF, et al. Meta-analysis of genome-wide association data identifies two loci influencing age at menarche. Nat Genet. 2009;41(6):648–50. pmid:19448620
- 8. Sulem P, Gudbjartsson DF, Rafnar T, Holm H, Olafsdottir EJ, Olafsdottir GH, et al. Genome-wide association study identifies sequence variants on 6q21 associated with age at menarche. Nat Genet. 2009;41(6):734–8. pmid:19448622
- 9. Zhu H, Shah S, Shyh-Chang N, Shinoda G, Einhorn WS, Viswanathan SR, et al. Lin28a transgenic mice manifest size and puberty phenotypes identified in human genetic association studies. Nat Genet. 2010;42(7):626–30. pmid:20512147
- 10. Cao G, Gao Z, Jiang Y, Chu M. Lin28 gene and mammalian puberty. Mol Reprod Dev. 2020;87(5):525–33. pmid:32363678
- 11. Hagan JP, Piskounova E, Gregory RI. Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells. Nat Struct Mol Biol. 2009;16(10):1021–5. pmid:19713958
- 12. Heo I, Joo C, Cho J, Ha M, Han J, Kim VN. Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA. Mol Cell. 2008;32(2):276–84. pmid:18951094
- 13. Lehrbach NJ, Armisen J, Lightfoot HL, Murfitt KJ, Bugaut A, Balasubramanian S, et al. LIN-28 and the poly(U) polymerase PUP-2 regulate let-7 microRNA processing in Caenorhabditis elegans. Nat Struct Mol Biol. 2009;16(10):1016–20. pmid:19713957
- 14. Piskounova E, Polytarchou C, Thornton JE, LaPierre RJ, Pothoulakis C, Hagan JP, et al. Lin28A and Lin28B inhibit let-7 microRNA biogenesis by distinct mechanisms. Cell. 2011;147(5):1066–79. pmid:22118463
- 15. Rybak A, Fuchs H, Smirnova L, Brandt C, Pohl EE, Nitsch R, et al. A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. Nat Cell Biol. 2008;10(8):987–93. pmid:18604195
- 16. Van Wynsberghe PM, Kai ZS, Massirer KB, Burton VH, Yeo GW, Pasquinelli AE. LIN-28 co-transcriptionally binds primary let-7 to regulate miRNA maturation in Caenorhabditis elegans. Nat Struct Mol Biol. 2011;18(3):302–8. pmid:21297634
- 17. Viswanathan SR, Daley GQ, Gregory RI. Selective blockade of microRNA processing by Lin28. Science. 2008;320(5872):97–100. pmid:18292307
- 18. Büssing I, Slack FJ, Grosshans H. let-7 microRNAs in development, stem cells and cancer. Trends Mol Med. 2008;14(9):400–9. pmid:18674967
- 19. Tsialikas J, Romer-Seibert J. LIN28: roles and regulation in development and beyond. Development. 2015;142(14):2397–404. pmid:26199409
- 20. Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature. 2000;403(6772):901–6. pmid:10706289
- 21. Slack FJ, Basson M, Liu Z, Ambros V, Horvitz HR, Ruvkun G. The lin-41 RBCC gene acts in the C. elegans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. Mol Cell. 2000;5(4):659–69. pmid:10882102
- 22. Ilbay O, Nelson C, Ambros V. C. elegans LIN-28 controls temporal cell fate progression by regulating LIN-46 expression via the 5’ UTR of lin-46 mRNA. Cell Rep. 2021;36:109670.
- 23. Pepper AS-R, McCane JE, Kemper K, Yeung DA, Lee RC, Ambros V, et al. The C. elegans heterochronic gene lin-46 affects developmental timing at two larval stages and encodes a relative of the scaffolding protein gephyrin. Development. 2004;131(9):2049–59. pmid:15073154
- 24. Stefani G, Chen X, Zhao H, Slack FJ. A novel mechanism of LIN-28 regulation of let-7 microRNA expression revealed by in vivo HITS-CLIP in C. elegans. RNA. 2015;21(5):985–96. pmid:25805859
- 25. Vadla B, Kemper K, Alaimo J, Heine C, Moss EG. lin-28 controls the succession of cell fate choices via two distinct activities. PLoS Genet. 2012;8(3):e1002588. pmid:22457637
- 26. Cho J, Chang H, Kwon SC, Kim B, Kim Y, Choe J, et al. LIN28A is a suppressor of ER-associated translation in embryonic stem cells. Cell. 2012;151(4):765–77. pmid:23102813
- 27. Graf R, Munschauer M, Mastrobuoni G, Mayr F, Heinemann U, Kempa S, et al. Identification of LIN28B-bound mRNAs reveals features of target recognition and regulation. RNA Biol. 2013;10(7):1146–59. pmid:23770886
- 28. Hafner M, Max KEA, Bandaru P, Morozov P, Gerstberger S, Brown M, et al. Identification of mRNAs bound and regulated by human LIN28 proteins and molecular requirements for RNA recognition. RNA. 2013;19(5):613–26. pmid:23481595
- 29. Wilbert ML, Huelga SC, Kapeli K, Stark TJ, Liang TY, Chen SX, et al. LIN28 binds messenger RNAs at GGAGA motifs and regulates splicing factor abundance. Mol Cell. 2012;48(2):195–206. pmid:22959275
- 30. Maklad A, Sedeeq M, Chan KM, Gueven N, Azimi I. Exploring Lin28 proteins: unravelling structure and functions with emphasis on nervous system malignancies. Life Sci. 2023;335:122275. pmid:37984514
- 31. Tan FE, Sathe S, Wheeler EC, Nussbacher JK, Peter S, Yeo GW. A transcriptome-wide translational program defined by LIN28B expression level. Mol Cell. 2019;73(2):304-313.e3. pmid:30527666
- 32. Tan FE, Sathe S, Wheeler EC, Yeo GW. Non-microRNA binding competitively inhibits LIN28 regulation. Cell Rep. 2021;36(6):109517. pmid:34380031
- 33. Nahar S, Morales Moya LJ, Brunner J, Hendriks G-J, Towbin B, Hauser YP, et al. Dynamics of miRNA accumulation during C. elegans larval development. Nucleic Acids Res. 2024;52(9):5336–55. pmid:38381904
- 34. Euling S, Ambros V. Heterochronic genes control cell cycle progress and developmental competence of C. elegans vulva precursor cells. Cell. 1996;84(5):667–76. pmid:8625405
- 35. Seggerson K, Tang L, Moss EG. Two genetic circuits repress the Caenorhabditis elegans heterochronic gene lin-28 after translation initiation. Dev Biol. 2002;243(2):215–25. pmid:11884032
- 36. Hendriks G-J, Gaidatzis D, Aeschimann F, Großhans H. Extensive oscillatory gene expression during C. elegans larval development. Mol Cell. 2014;53(3):380–92. pmid:24440504
- 37. Meeuse MW, Hauser YP, Morales Moya LJ, Hendriks G-J, Eglinger J, Bogaarts G, et al. Developmental function and state transitions of a gene expression oscillator in Caenorhabditis elegans. Mol Syst Biol. 2020;16(7):e9498. pmid:32687264
- 38. Ilbay O, Ambros V. Regulation of nuclear-cytoplasmic partitioning by the lin-28-lin-46 pathway reinforces microRNA repression of HBL-1 to confer robust cell-fate progression in C. elegans. Development. 2019;146(21):dev183111. pmid:31597658
- 39. Olmedo M, Geibel M, Artal-Sanz M, Merrow M. A high-throughput method for the analysis of larval developmental phenotypes in Caenorhabditis elegans. Genetics. 2015;201(2):443–8. pmid:26294666
- 40. Chen J, Caswell-Chen EP. Facultative vivipary is a life-history trait in Caenorhabditis elegans. J Nematol. 2004;36(2):107–13. pmid:19262794
- 41. Rausch M, Ecsedi M, Bartake H, Müllner A, Grosshans H. A genetic interactome of the let-7 microRNA in C. elegans. Dev Biol. 2015;401(2):276–86. pmid:25732775
- 42. Loughlin FE, Gebert LFR, Towbin H, Brunschweiger A, Hall J, Allain FH-T. Structural basis of pre-let-7 miRNA recognition by the zinc knuckles of pluripotency factor Lin28. Nat Struct Mol Biol. 2011;19(1):84–9. pmid:22157959
- 43. Nam Y, Chen C, Gregory RI, Chou JJ, Sliz P. Molecular basis for interaction of let-7 microRNAs with Lin28. Cell. 2011;147(5):1080–91. pmid:22078496
- 44. Ustianenko D, Chiu H-S, Treiber T, Weyn-Vanhentenryck SM, Treiber N, Meister G, et al. LIN28 selectively modulates a subclass of Let-7 microRNAs. Mol Cell. 2018;71(2):271-283.e5. pmid:30029005
- 45. Nelson C, Ambros V. Multi-dimensional regulation of LIN-28 temporal expression dynamics in the C. elegans heterochronic gene cascade. bioRxiv. 2025.
- 46. Moss EG. Heterochronic genes and the nature of developmental time. Curr Biol. 2007;17(11):R425-34. pmid:17550772
- 47. Olmedo M, Merrow M, Geibel M. Sleeping beauty? Developmental timing, sleep, and the circadian clock in Caenorhabditis elegans. Adv Genet. 2017;97:43–80. pmid:28838356
- 48. Tsiairis C, Großhans H. Gene expression oscillations in C. elegans underlie a new developmental clock. Curr Top Dev Biol. 2021;144:19–43. pmid:33992153
- 49. Aeschimann F, Kumari P, Bartake H, Gaidatzis D, Xu L, Ciosk R, et al. LIN41 post-transcriptionally silences mRNAs by two distinct and position-dependent mechanisms. Mol Cell. 2017;65(3):476-489.e4. pmid:28111013
- 50. Aeschimann F, Neagu A, Rausch M, Großhans H. A single let-7 target to coordinate transition to adulthood. Life Science Alliance. 2019;2:e201900335.
- 51. Ecsedi M, Rausch M, Großhans H. The let-7 microRNA directs vulval development through a single target. Dev Cell. 2015;32(3):335–44. pmid:25669883
- 52. Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 1993;75(5):855–62. pmid:8252622
- 53. Dorsett Y, McBride KM, Jankovic M, Gazumyan A, Thai T-H, Robbiani DF, et al. MicroRNA-155 suppresses activation-induced cytidine deaminase-mediated Myc-Igh translocation. Immunity. 2008;28(5):630–8. pmid:18455451
- 54. Drexel T, Mahofsky K, Latham R, Zimmer M, Cochella L. Neuron type-specific miRNA represses two broadly expressed genes to modulate an avoidance behavior in C. elegans. Genes Dev. 2016;30(18):2042–7. pmid:27688400
- 55. Johnston RJ, Hobert O. A microRNA controlling left/right neuronal asymmetry in Caenorhabditis elegans. Nature. 2003;426(6968):845–9. pmid:14685240
- 56. Lu LF, Gasteiger G, Yu IS, Chaudhry A, Hsin JP, Lu Y, et al. A single miRNA-mRNA interaction affects the immune response in a context- and cell-type-specific manner. Immunity. 2015;43:52–64.
- 57. Teng G, Hakimpour P, Landgraf P, Rice A, Tuschl T, Casellas R, et al. MicroRNA-155 is a negative regulator of activation-induced cytidine deaminase. Immunity. 2008;28(5):621–9. pmid:18450484
- 58. Chen X, Castro SA, Liu Q, Hu W, Zhang S. Practical considerations on performing and analyzing CLIP-seq experiments to identify transcriptomic-wide RNA-protein interactions. Methods. 2019;155:49–57. pmid:30527764
- 59. Vieira-Vieira CH, Selbach M. Opportunities and challenges in global quantification of RNA-protein interaction via UV cross-linking. Front Mol Biosci. 2021;8:669939. pmid:34055886
- 60. Welte T, Goulois A, Stadler MB, Hess D, Soneson C, Neagu A, et al. Convergence of multiple RNA-silencing pathways on GW182/TNRC6. Mol Cell. 2023;83(14):2478-2492.e8. pmid:37369201
- 61. Arribere JA, Bell RT, Fu BXH, Artiles KL, Hartman PS, Fire AZ. Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014;198(3):837–46. pmid:25161212
- 62. Katic I, Xu L, Ciosk R. CRISPR/Cas9 genome editing in Caenorhabditis elegans: evaluation of templates for homology-mediated repair and knock-ins by homology-independent DNA repair. G3 (Bethesda). 2015;5(8):1649–56. pmid:26044730
- 63. Dokshin GA, Ghanta KS, Piscopo KM, Mello CC. Robust genome editing with short single-stranded and long, partially single-stranded DNA donors in Caenorhabditis elegans. Genetics. 2018;210(3):781–7. pmid:30213854
- 64. Ghanta KS, Mello CC. Melting dsDNA donor molecules greatly improves precision genome editing in. Genetics. 2020;216:643–50.
- 65. Gaidatzis D, Lerch A, Hahne F, Stadler MB. QuasR: quantification and annotation of short reads in R. Bioinformatics. 2015;31(7):1130–2. pmid:25417205
- 66. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9(7):676–82. pmid:22743772
- 67. Bagga S, Bracht J, Hunter S, Massirer K, Holtz J, Eachus R, et al. Regulation by let-7 and lin-4 miRNAs results in target mRNA degradation. Cell. 2005;122(4):553–63. pmid:16122423
- 68. Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002;30(1):207–10. pmid:11752295






















English (US) ·
French (CA) ·